Microsoft word - 3c792aa7-2abf-8c38.doc

PXR Influences Endocrine Therapies in Breast Cancer PXR Influences The Efficiency of Endocrine Karin Höckenström
Department of medical nutrition, Karolinska Institute. The summer science school with biomedical orientation at KI, 2000. Supervisor: Dr Jeanette Webster, department of medical nutrition, Karolinska Institute, 141 86
Huddinge. Tel: 08-585 837 18, 08-585 837 12
PXR Influences Endocrine Therapies in Breast Cancer The Human Orphan Receptor PXR Influences
The Efficiency of Endocrine Therapies in
Breast Cancer

Karin Höckenström
Department of Medical nutrition, Karolinska Institute, 141 86 Huddinge.
Abstract
PXR (Pregnane X receptor) is known to induce expression of the drug
metabolizing enzyme CYP3A (Cytochrome P450 monooxygenase 3A). PXR mRNA has
been detected in both normal and neoplastic human breast tissue. CYP3A4 enzymes have
also been found in human breast cancer tissue. It was suggested that there might be a
PXR/CYP3A regulated pathway that would influence the efficiency of drug therapy in
breast cancer (Dotzlaw et al. 1999). The data presented here shows that tamoxifen and
its active metabolite 4-hydroxytamoxifen can activate PXR at a micromolar range similar
to rifampicin that is a known activator of PXR. Additional data shows that PXR is present
in BK MCF-1 breast cancer cell line and that it is active. Tamoxifen is an anti-oestrogen
and the major drug used in treatment for breast cancer. It is estimated that more than
seven million patients undergo tamoxifen treatment every year (Gradishar and Jordan,
1997). Two significant side effects with tamoxifen are uterine cancer and tamoxifen
resistance. A majority of the patients that are treated with tamoxifen under a longer
period eventually become resistant. As yet the mechanism that causes tamoxifen
resistance is unknown. Tamoxifen is a partial agonist and has been shown to induce
expression of the multidrug resistance protein MRP2 in monkey liver. It is possible that
PXR is responsible for the agonist properties of tamoxifen and that it could be involved in
tamoxifen resistance.
Introduction
When the ligand is in place, the receptor
protein undergoes a structural change and progesterone and cortisol regulate a number of processes in higher eukaryotes including homeostasis and differentiation. They are where it binds to a short DNA sequence called Hormone Response Element (HRE) and there receptor protein in the cytoplasm. A typical it regulates the transcription of target genes. target cell contains 10,000 steroid receptors. PXR Influences Endocrine Therapies in Breast Cancer Fig. 2 The two isoforms of human PXR. The numbers represent the amino acids residues. DBD, DNA binding domain. PXR 2 has a deletion of 123 nucleotides in the LBD, ligand Fig. 1 The steroid hormone receptor can be located either in the cytoplasm or in the PXR is most abundant in liver and intestine, (Bertilsson et al. 1998) yet PXR mRNA has from human liver cDNA library. PXR is a novel neoplastic breast tissue (Dotzlaw et al. orphan nuclear receptor since it lacks an 1999). Nuclear receptors regulate metabolic
pathways by regulating the transcription of activated in vitro by both naturally occurring progesterone and synthetic glucocorticoids at transcription of the CYP3A genes that encode high concentrations. A number of clinically for the drug-metabolizing CYP3A enzymes. used drugs such as the antibiotic rifampicin The CYP3A enzymes are responsible for the metabolism of almost 60% of all clinically used drugs (Lehman et al. 1998). This makes PXR very interesting since it is crucial to progesterone and is included in the steroid understand the mechanism underlying CYP3A receptor superfamily. PXR has 2 isoforms: PXR Influences Endocrine Therapies in Breast Cancer Materials and Methods
Plasmid Prep of RSV β-gal
Transfection
CV-1 cells were plated out on 24-well plates 1.2x105 cells/well. The transfection mixes RNA prep from BK MCF-7, SF MCF-7,
contained 1 µl of Fugene 6, 33 ng receptor ZR75-1 AND T47D
expression vector (hPXR), 100 ng of reporter RNA was extracted from frozen cell pellet. plasmid (CYP3A4), 356 ng of carrier plasmid The cell pellet was dissolved in 700 µl guanidium isothiocyanatate (GITC). 700 µl 2 expression vector/well. Cells were transfected M NaAc pH 4.0, 700 µl phenol, 140 µl CHCl3 over night. The medium was changed to F12 were added. The solutions were centrifuged Media with 10% delipidated serum containing rifampicin, tamoxifen or 4-hydroxytamoxifen at 7 different concentrations ranging from 0.1 solutions at –20°C for 1 hour. The solutions nM to 100 µM. DMSO was used as control. Cells were incubated over night. Cell extracts rpm/15000xg). Pellet was dissolved in GITC were prepared and assayed for luciferin and solutions precipitated at –20°C for 1 hour. Solutions were centrifuged (15 min, 4°C, 12000 rpm/15000xg). Pellet was washed with PCR was carried out in a total of 25 µl, ethanol (70%) and centrifuged (5 min, 4°C, containing 2 µl of cDNA/RNA plasmid, 0.5 12000 rpm/15000xg). Pellet was air dried for mM dNTPs, buffer, 10 pmol PXR nest 3`, 10 15 min at room temp then dissolved in 100 µl pmol PXR nest 5`,10 pmol β-actin 5`, pmol A regime of 95°C for 5 minutes followed by cDNA prep from BK MCF-7, SF MCF-7,
30 cycles of 94°C for 1 min, 50°C for 1 min, ZR75-1 AND T47D
72°C for 1.5 min and finished with 72°C for 7 min was used. PCR products were separated inhibitor were added and the solutions were on an agarose (1%) gel stained with Ethidium made up to 10 µl with sterile filtered H2O. Bromide. The primers used consisted of hPXR The solutions were put at 37°C for 15 min, 65°C for 5 min. 1 µl oligo dT was added then TCGGAGATCACCCGGAAGAC 3’; fragment size put at 70°C for 10 min, put on ice to cool. 4 µl superscript buffer, 2 µl DTT and 2 µl 20 mM dNTPs were added. Put at 42°C for 2 min. 1 µl superscript reverse transcriptase was added. Put at 42°C for 50 min and finally put PXR Influences Endocrine Therapies in Breast Cancer was run as shown in fig 4. PXR was present PXR is present in breast cancer cell lines
in BK MCF-7 DNA sample and absent in the RT-PCR was used to determine whether PXR was expressed any of the breast cancer cell lines used. The cell lines that were used were BK MCF-7, SF MCF-7, ZR75-1 and T47D. On the first agarose gel (1%) no signals were seen. The conclusion was that the primers could have interacted or that the amount of PXR was too small to detect with agarose gel Both 7) T47D RNA and 8)
T47D DNA were visible which can’t be right Polyacrylamide gel. The gel was analyzed by since RNA can’t possibly bind to the PXR primers. 6) BK MCF-1 DNA contained PXR
indefinite. Another PCR (1) was set up and and 5) BK MCF-7 RNA didn’t. That verifies
this time the primers were separated on a that the BK MCF-7 cell line contain PXR. contamination were encountered as shown in SF RNA, 4, SF cDNA, 5,BK RNA, 6, BK cDNA, 7, T47D RNA, 8,T47D cDNA, 9,ZR75-1 RNA,
Tamoxifen and 4-hydroxytamoxifen can
activate PXR
activator of PXR. Rifampicin was therefore hydroxytamoxifen and tamoxifen. Figure 5 Fig. 3 The agarose gel analysis indicated that there were PXR in almost all of the (1) samples except water suggesting that there had to be a contamination. Templates: 1,H2O, 2,HepG2 RNA, 3,HepG2 cDNA, 4,LMCAT RNA, 5,LMCAT cDNA, 6,BK RNA, 7,BK cDNA, 8,SF RNA, 9,SF cDNA, 10, T47D RNA, 11,T47D cDNA, 12,ZR75 RNA, 13,ZR75 cDNA, 14,PXR plasmid (1/10). We used agarose gel analysis to find out which compound/s were contaminated. We replaced H2O, RNAse inhibitor, dNTPS, superscript buffer and DTT. A new RT-PCR PXR Influences Endocrine Therapies in Breast Cancer Dose response curves of rifampicin, both Discussion
The data presented here supports the theory run. The first two transfections failed. A third that tamoxifen and 4-hydroxytamoxifen can activate PXR in vitro. The required Rifampcin induced a 9 fold induction at 10 concentration, 10 µM, is however high. The µM, 4-hydroxy tamoxifen gave a 6.2 fold results imply that BK MCF-7 breast cancer cell lines contain PXR and that it is active. More tests need to be run before any final considered activation. More tests need to be conclusions can be drawn. What is to be done run before any final conclusions and statistics next is to look for the CYP3A enzyme in the can be made. However it looks as if both cell line and see if it is actively metabolizing tamoxifen. Another task is to see if the upgraded. The tests need to be repeated on PXR/CYP3A regulated pathway works in vivo. One essential goal is to determine if PXR is Cells were analyzed for luciferase and ß-gal involved in tamoxifen resistance. It is crucial activity and the data represent the mean of 3 behind drug interaction and enhance the drug folded induction at 10 µM yet tamoxifen and 4-hydroxy- tamoxifen also gave good inductions at 10 µM. 4-hydroxytamoxifen gave a 6.2 fold induction and tamoxifen gave a 4.4 fold induction.
PXR is present in the BK MCF-7 breast
cancer cell line and it is active
The cells were transfected and treated with
rifampicin, 4-hydroxytamoxifen and tamoxifen. Rifampicin and PXR was used as a positive control. Rifampicin activated PXR in the BK MCF-7 breast cancer cell. This suggests that PXR is not only present in the cell line, it is also active, as shown in diagram2. PXR Influences Endocrine Therapies in Breast Cancer References
1. Kliewer, S., Moore, J., Wade, L., Staudinger, J., Watson, M., Jones, S., McKee, D., Oliver, B., T., Zetterstrom, R.,, Perlmann, T., and activated by pregnanes defines a novel steroid signaling pathway. Cell, 92: 73-82, 1998. 2. Lehmann, J., McKee, D., Watson, M., Willson, T., Moore, J., and Kliewer, S. The human compounds that regulate CYP3A4 expression and cause drug interactions. J. Clin. Invest., 3. Dotzlaw, H., Leygue, E., Watson, P., and Murphy, L. The human orphan receptor PXR messenger RNA is expressed in both normal and neoplastic breast tissue. Clinical Cancer 4. Bertilsson, G., Heidrich, J., Svensson, K., Åsman, M., Jendeberg, L., Sydow-Bäckman, M., Ohlsson, R., Postlind, H., Blomquist, P., and Berkenstam, A. Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc. Natl. Acad. Sci. USA. Vol. 95, pp. 12208-12213, 1998. 5. Blumberg, B., Sabbagh, jr, W., Juguilon, H., Bolado,jr, J., Van Meter, C., S. Ong, E., and M. Evans, R. PXR, a novel steroid and xenobiotic 6. Favoni, R., de Cupis, A. Steroidal and nonsteroidal oestrogen antagonists in breast cancer: basic and clinical apprasial. TiPS, vol. 7. Kauffmann, H., Keppler, D., Gant, T. and (cmrp/cmoat) gene expression in nonhuman primates treated with rifampicin or tamoxifen.

Source: http://www.student.nada.kth.se/~u106vf26/uppsatser/PXR.pdf